After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat IFNG Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_138880.2
Tamanho de cDNA:471bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus ?interferon gamma.
Sinónimo de gene:IFNG2, Ifng
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80234-ACG$225
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80234-ACR$225
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80234-CF$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80234-CH$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80234-CM$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80234-CY$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de expressão)RG80234-G$75
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80234-NF$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80234-NH$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80234-NM$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80234-NY$195
Ratazana Interferon Gamma/IFN gamma/IFNG clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80234-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

Referências
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Size / Price
    Catálogo: RG80234-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"