After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rat HepaCAM2 natural ORF mammalian expression plasmid

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat HEPACAM2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001106580.2
Tamanho de cDNA:1392bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus HEPACAM family member 2.
Sinónimo de gene:RGD1305697, Hepacam2
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

HepaCAM2 belongs to the immunoglobulin family. HepaCAM2, together with HEPACAM1, are cell adhesion molecules. HEPACAM1 modulates cell adhesion and migration. It also inhibits cancer cell growth. HepaCAM2 contains 2 Ig-like C2-type (immunoglobulin-like) domains. The immunoglobulin domain is a type of protein domain that consists of a 2-layer sandwich of between 7 and 9 antiparallel β-strands arranged in two β-sheets with a Greek key topology. Members of the immunoglobulin superfamily are found in hundreds of proteins of different functions.

Referências
  • Moh MC, et al. (2008) Expression of hepaCAM is downregulated in cancers and induces senescence-like growth arrest via a p53/p21-dependent pathway in human breast cancer cells. Carcinogenesis. 29(12):2298-305.
  • Moh MC, et al. (2005) Structural and functional analyses of a novel ig-like cell adhesion molecule, hepaCAM, in the human breast carcinoma MCF7 cells. J Biol Chem. 280(29):27366-74.
  • Chung Moh M, et al. (2005) Cloning and characterization of hepaCAM, a novel Ig-like cell adhesion molecule suppressed in human hepatocellular carcinoma. J Hepatol. 42(6):833-41.
  • Size / Price
    Catálogo: RG80242-UT
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade2-3 weeksInstruções de envio
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"