Encomenda rápida

Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem)

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana HSPD1 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_022229.2
    Tamanho de cDNA:1722bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus heat shock protein 1 (chaperonin).
    Sinónimo de gene:Hsp60,Hspd1-30p
    Espécie:Rat
    Vetor:pCMV3-untagged
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with HSPD1 qPCR primers for gene expression analysis, RP300978 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81014-ACG$245
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81014-ACR$245
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81014-ANG$245
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81014-ANR$245
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81014-CF$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81014-CH$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81014-CM$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81014-CY$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81014-NF$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81014-NH$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81014-NM$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81014-NY$215
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de expressão)RG81014-U$75
    Ratazana HSPD1/HSP60 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81014-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    HSPD1, also known as HSP60, is a member of the chaperonin family. HSPD1 may function as a signaling molecule in the innate immune system. This protein is essential for the folding and assembly of newly imported proteins in the mitochondria. It may also prevent misfolding and promote the refolding and proper assembly of unfolded polypeptides generated under stress conditions in the mitochondrial matrix. HSPD1 gene is adjacent to a related family member and the region between the 2 genes functions as a bidirectional promoter. Several pseudogenes have been associated with this gene. Mutations associated with this gene cause autosomal recessive spastic paraplegia 13.Defects in HSPD1 are a cause of spastic paraplegia autosomal dominant type 13 (SPG13). Spastic paraplegia is a degenerative spinal cord disorder characterized by a slow, gradual, progressive weakness and spasticity of the lower limbs. Defects in HSPD1 are the cause of leukodystrophy hypomyelinating type 4 (HLD4); also called mitochondrial HSP60 chaperonopathy or MitCHAP-60 disease. HLD4 is a severe autosomal recessive hypomyelinating leukodystrophy. HSPD1 is cinically characterized by infantile-onset rotary nystagmus, progressive spastic paraplegia, neurologic regression, motor impairment, profound mental retardation. Death usually occurrs within the first two decades of life.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    Referências
  • Hansen J J, et al. (2002) Hereditary spastic paraplegia SPG13 is associated with a mutation in the gene encoding the mitochondrial chaperonin Hsp60. Am J Hum Genet. 70: 1328-32.
  • Magen D, et al. (2008) Mitochondrial Hsp60 chaperonopathy causes an autosomal-recessive neurodegenerative disorder linked to brain hypomyelination and leukodystrophy. Am J Hum Genet. 83: 30-42.
  • Venner TJ, et al. (1990) Nucleotide sequences and novel structural features of human and Chinese hamster hsp60 (chaperonin) gene families. DNA Cell Biol. 9 (8): 545-52.
  • Size / Price
    Catálogo: RG81014-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"