After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat HSP90AB1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:AY695393.1
Tamanho de cDNA:2175bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus heat shock protein 90 alpha (cytosolic), class B member 1.
Sinónimo de gene:HSPC2, Hspcb, HSP90B, HSP90-BETA
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81038-ACG$245
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81038-ACR$245
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81038-ANG$245
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81038-ANR$245
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81038-CF$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81038-CH$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81038-CM$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81038-CY$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81038-NF$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81038-NH$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81038-NM$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81038-NY$215
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de expressão)RG81038-U$75
Ratazana HSP90/HSP90AB1 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81038-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG81038-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"