Encomenda rápida

Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana HAAO Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:861bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus 3-hydroxyanthranilate 3,4-dioxygenase with C terminal His tag.
    Sinónimo de gene:Haao
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    ( We provide with HAAO qPCR primers for gene expression analysis, RP300591 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80627-ACG$225
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80627-ACR$225
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80627-ANG$225
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80627-ANR$225
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80627-CF$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80627-CH$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80627-CM$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80627-CY$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80627-NF$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80627-NH$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80627-NM$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80627-NY$195
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de expressão)RG80627-U$75
    Ratazana HAAO / 3-HAO clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80627-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: RG80627-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.