Encomenda rápida

Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat GOT1 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1242bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus glutamic-oxaloacetic transaminase 1, soluble (aspartate aminotransferase 1) with N terminal HA tag.
Sinónimo de gene:cCAT, Aspat, Gaspat, cAspAT
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80493-ACG$225
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80493-ACR$225
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80493-ANG$225
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80493-ANR$225
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80493-CF$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80493-CH$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80493-CM$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80493-CY$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80493-NF$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80493-NH$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80493-NM$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80493-NY$195
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80493-U$75
Ratazana Aspartate aminotransferase / GOT1 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80493-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

Aspartate aminotransferase is a pyridoxal phosphate-dependent enzyme which exists in cytoplasmic and mitochondrial forms, aspartate aminotransferase and GOT2, respectively. GOT plays a role in amino acid metabolism and the urea and tricarboxylic acid cycles. The two enzymes are homodimeric and show close homology. There is a rare in-frame deletion in aspartate aminotransferase gene, which inactivates cytosolic aspartate aminotransferase(cAST) enzyme in the Old Order Amish. This may help to understand structure and function of the enzyme and would be useful for predicting serum aspartate AST levels.

  • Shen H, et al. (2011) Genome-wide association study identifies genetic variants in GOT1 determining serum aspartate aminotransferase levels. J Hum Genet. 56(11):801-5.
  • Doonan S, et al. (1985) Structural and genetic relationships between cytosolic and mitochondrial isoenzymes. Int J Biochem. 16(12):1193-9.
  • Panteghini M. (1990) Aspartate aminotransferase isoenzymes. Clin Biochem. 23(4):311-9.
  • Bousquet-Lemercier B, et al. (1990) Properties of human liver cytosolic aspartate aminotransferase mRNAs generated by alternative polyadenylation site selection. Biochemistry. 29(22):5293-9.
  • Size / Price
    Catálogo: RG80493-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.