After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat GLRX Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_022278.1
Tamanho de cDNA:324bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus glutaredoxin (thioltransferase) with C terminal Flag tag.
Sinónimo de gene:Grx, Glrx1
Espécie:Rat
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81101-ACG$225
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81101-ACR$225
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81101-ANG$225
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81101-ANR$225
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81101-CF$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81101-CH$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81101-CM$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81101-CY$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81101-NF$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81101-NH$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81101-NM$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81101-NY$195
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de expressão)RG81101-U$75
Ratazana glutaredoxin-1 / GRX1 / GLRX clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81101-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Glutaredoxin-1, also known as GRX1 and GLRX, belongs to the glutaredoxin family. Glutaredoxins are small redox enzymes that use glutathione as a cofactor. Glutaredoxins are oxidized by substrates, and reduced non-enzymatically by glutathione. Glutaredoxin-1 functions as an electron carrier in the glutathione-dependent synthesis of deoxyribonucleotides by the enzyme ribonucleotide reductase. Glutaredoxin-1 exists in either a reduced or an oxidized form. Glutaredoxins function as electron carriers in the glutathione-dependent synthesis of deoxyribonucleotides by the enzymeribonucleotide reductase.

Referências
  • Holmgren A. et al., 1988, FEMS Microbiol Rev. 4 (4): 271-97.
  • Holmgren A. 1988, Biochem Soc Trans. 16 (2): 95-6.
  • Holmgren A. 1989, J Biol Chem. 264 (24): 13963-6.
  • Size / Price
    Catálogo: RG81101-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"