After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat FTL Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:BC061525.1
Tamanho de cDNA:552bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus ferritin, light polypeptide with N terminal HA tag.
Sinónimo de gene:Ftl1
Espécie:Rat
Vetor:pCMV3-N-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80491-ACG$225
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80491-ACR$225
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80491-ANG$225
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80491-ANR$225
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80491-CF$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80491-CH$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80491-CM$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80491-CY$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80491-NF$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80491-NH$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80491-NM$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80491-NY$195
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de expressão)RG80491-U$75
Ratazana FTL/ferritin, light polypeptide clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80491-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Ferritin, light polypeptide (FTL) is the light subunit of the ferritin protein. Ferritin is the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Storage of iron in the tissues occurs in the form of ferritin and hemosiderin. The latter originates from ferritin that has undergone intracellular digestion of its protein shell, leaving the iron core. Ferritin and hemosiderin are components of a continuum. Ferritin has been identified in all types of living organisms: animals, plants, molds, and bacteria. Whithin the protein shell of ferritin, iron is first oxidized to the ferric state for storage as ferric oxyhdroxide. Thus, ferritin removes excess iron from the cell sap where it could otherwise participate in peroxidation mechanisms.

Referências
  • Munro HN, et al. (1988) The ferritin genes: structure, expression, and regulation. Ann N Y Acad Sci. 526: 113-23.
  • Zhang Y, et al. (2008) Comparative proteomic analysis of human placenta derived from assisted reproductive technology. Proteomics. 8 (20): 4344-56.
  • Lebo RV, et al. (1986) Human ferritin light chain gene sequences mapped to several sorted chromosomes. Hum Genet. 71 (4): 325-8.
  • Size / Price
    Catálogo: RG80491-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"