After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana FCN1/FCNA clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat FCN1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_031348.2
Tamanho de cDNA:1008bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus ficolin (collagen/fibrinogen domain containing) 1.
Sinónimo de gene:Fcna, MGC108660, Fcn1
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Fundo

Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. The Ficolin family of proteins are characterized by the presence of a leader peptide, a short N-terminal segment, followed by a collagen-like region, and a C-terminal fibrinogen-like domain. Ficolins are humoral molecules of the innate immune systems which recognize carbohydrate molecules on pathogens, apoptotic and necrotic cells. Three Ficolins have been identified in humans: L-Ficolin, H-Ficolin and M-Ficolin (also referred to as Ficolin-2, -3 and -1, respectively). They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Dysfunction or abnormal expressions of Ficolins may involved in the pathogenesis of human diseases including infectious and inflammatory diseases, autoimmune disease and clinical syndrome of preeclampsia. They are soluble oligomeric defence proteins with lectin-like activity and they are structurally similar to the human collectins, mannan-binding lectin (MBL) and surfactant protein A and D. Upon recognition of the infectious agent, the Ficolins act through two distinct routes: initiate the lectin pathway of complement activation through attached serine proteases (MASPs), and a primitive opsonophagocytosis thus limiting the infection and concurrently orchestrating the subsequent adaptive clonal immune response. Ficolin-1 (FCN1) is predominantly expressed in the peripheral blood leukocytes.

Referências
  • Thiel S. (2007) Complement activating soluble pattern recognition molecules with collagen-like regions, mannan-binding lectin, ficolins and associated proteins. Mol Immunol. 44(16): 3875-88.
  • Zhang XL, et al. (2008) Ficolins: structure, function and associated diseases. Adv Exp Med Biol. 632: 105-15.
  • Garred P, et al. (2009) MBL2, FCN1, FCN2 and FCN3-The genes behind the initiation of the lectin pathway of complement. Mol Immunol. 46(14): 2737-44.
  • Size / Price
    Catálogo: RG80255-UT
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"