Encomenda rápida

Text Size:AAA

Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat FAM45A Informações sobre o produto de clone de cDNA
Tamanho de cDNA:708bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus family with sequence similarity 45, member A with C terminal His tag.
Sinónimo de gene:RGD1308326
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81049-ACG$225
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81049-ACR$225
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81049-ANG$225
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81049-ANR$225
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81049-CF$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81049-CH$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81049-CM$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81049-CY$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81049-NF$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81049-NH$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81049-NM$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81049-NY$195
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de expressão)RG81049-U$75
Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81049-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG81049-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.