Encomenda rápida

Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana FAM45A Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:708bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus family with sequence similarity 45, member A with C terminal His tag.
    Sinónimo de gene:RGD1308326
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    ( We provide with FAM45A qPCR primers for gene expression analysis, RP301013 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81049-ACG$225
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81049-ACR$225
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81049-ANG$225
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81049-ANR$225
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81049-CF$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81049-CH$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81049-CM$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81049-CY$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81049-NF$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81049-NH$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81049-NM$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81049-NY$195
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de expressão)RG81049-U$75
    Ratazana FAM45A clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81049-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: RG81049-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.