Encomenda rápida

Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ratazana FABP7 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:399bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus fatty acid binding protein 7, brain with N terminal HA tag.
Sinónimo de gene:Fabp7
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
( We provide with FABP7 qPCR primers for gene expression analysis, RP300438 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80474-ACG$225
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80474-ACR$225
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80474-ANG$225
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80474-ANR$225
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80474-CF$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80474-CH$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80474-CM$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80474-CY$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80474-NF$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80474-NH$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80474-NM$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80474-NY$195
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80474-U$75
Ratazana BLBP/FABP7 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80474-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

BLBP, also known as FABP7, is a brain fatty acid binding protein. Fatty acid binding proteins (FABPs) are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. FABP7 binds DHA with the highest affinity among all of the FABPs. FABPs may play roles in fatty acid uptake, transport, and metabolism. BLBP is expressed, during development, in radial glia by the activation of notch receptors. It was shown that reelin induces FABP7 expression in neural progenitor cells via notch-1 activation. BLBP variation is linked to weak prepulse inhibition(PPI) in mice and deficit in PPI is an endophenotypic trait observed in schizophrenia patients and their relatives.

  • Shi YE, et al. (1997) Antitumor activity of the novel human breast cancer growth inhibitor, mammary-derived growth inhibitor-related gene, MRG. Cancer Res. 57(15):3084-91.
  • Young JK, et al. (1997) Immunoreactivity for brain-fatty acid binding protein in gomori-positive astrocytes. Glia. 16(3):218-26.
  • Xu LZ, et al. (1996) Ligand specificity of brain lipid-binding protein. J Biol Chem. 271(40): 24711-9.
  • Size / Price
    Catálogo: RG80474-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.