eRF1 cDNA ORF Clone, Rat, untagged

Cat: RG80998-UT

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All eRF1 Reagents

CRO Services

Product recommended


All eRF1 Reagents

eRF1 cDNA ORF Clone, Rat, untagged General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1314 bp
Description
Full length Clone DNA of Rat eukaryotic translation termination factor 1.

Plasmid

Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

eRF1 Background Information

Full Name
eukaryotic translation termination factor 1

eRF1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
eRF1 cDNA ORF Clone in Cloning Vector, Rat RG80998-U
eRF1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80998-ACGLN
eRF1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80998-ACG
eRF1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80998-ANG
eRF1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80998-ACR
eRF1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80998-ANR
eRF1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80998-CF
eRF1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80998-NF
eRF1 cDNA ORF Clone, Rat, C-His tag RG80998-CH
eRF1 cDNA ORF Clone, Rat, N-His tag RG80998-NH
eRF1 cDNA ORF Clone, Rat, C-HA tag RG80998-CY
eRF1 cDNA ORF Clone, Rat, N-HA tag RG80998-NY
eRF1 cDNA ORF Clone, Rat, C-Myc tag RG80998-CM
eRF1 cDNA ORF Clone, Rat, N-Myc tag RG80998-NM
eRF1 qPCR Primer Pairs, Rat RP300962

eRF1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
eRF1 cDNA ORF Clone in Cloning Vector, Mouse MG53449-U
eRF1 cDNA ORF Clone, Mouse, untagged MG53449-UT
eRF1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53449-ACGLN
eRF1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53449-ACG
eRF1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53449-ANG
eRF1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53449-ACR
eRF1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53449-ANR
eRF1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53449-CF
eRF1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53449-NF
eRF1 cDNA ORF Clone, Mouse, C-His tag MG53449-CH
eRF1 cDNA ORF Clone, Mouse, N-His tag MG53449-NH
eRF1 cDNA ORF Clone, Mouse, C-HA tag MG53449-CY
eRF1 cDNA ORF Clone, Mouse, N-HA tag MG53449-NY
eRF1 cDNA ORF Clone, Mouse, C-Myc tag MG53449-CM
eRF1 cDNA ORF Clone, Mouse, N-Myc tag MG53449-NM

eRF1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
eRF1 cDNA ORF Clone in Cloning Vector, Human HG18435-U
eRF1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18435-ACGLN
info info
添加购物车成功! 添加购物车失败!