After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat ESAM Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001004245.1
Tamanho de cDNA:1185bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus endothelial cell adhesion molecule.
Sinónimo de gene:MGC94065, Esam
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80241-ACG$225
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80241-ACR$225
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80241-CF$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80241-CH$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80241-CM$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80241-CY$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de expressão)RG80241-G$75
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80241-NF$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80241-NH$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80241-NM$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80241-NY$195
Ratazana Endothelial Cell Adhesion Molecule clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80241-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Endothelial cell-selective adhesion molecule (ESAM) is a member of JAM family of immunoglobulin superfamily and consists of one V-type and one C2-type immunoglobulin domain, as well as a hydrophobic signal sequence, a single transmembrane region, and a cytoplasmic domain. It is specifically expressed at endothelial tight junctions and on activated platelets. ESAM at endothelial tight junctions participates in the migration of neutrophils through the vessel wall, possibly by influencing endothelial cell contacts. The adaptor protein membrane-associated guanylate kinase MAGI-1 has been identified as an intracellular binding partner of ESAM. Previous studies have indicated that ESAM regulates angiogenesis in the primary tumor growth and endothelial permeability. It suggest that ESAM has a redundant functional role in physiological angiogenesis but serves a unique and essential role in pathological angiogenic processes such as tumor growth.

Referências
  • Ishida T, et al. (2003) Targeted disruption of endothelial cell-selective adhesion molecule inhibits angiogenic processes in vitro and in vivo. J Biol Chem. 278(36): 34598-604.
  • Wegmann F, et al. (2004) Endothelial adhesion molecule ESAM binds directly to the multidomain adaptor MAGI-1 and recruits it to cell contacts. Exp Cell Res. 300(1): 121-33.
  • Wegmann F, et al. (2006) ESAM supports neutrophil extravasation, activation of Rho, and VEGF-induced vascular permeability. J Exp Med. 203(7): 1671-7.
  • Hara T, et al. (2009) Endothelial cell-selective adhesion molecule regulates albuminuria in diabetic nephropathy. Microvasc Res. 77(3): 348-55.
  • Cangara HM, et al. (2010) Role of endothelial cell-selective adhesion molecule in hematogeneous metastasis. Microvasc Res. 80(1): 133-41.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"