Encomenda rápida

Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana EPB4.1L5 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001012023.1
    Tamanho de cDNA:1515bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus erythrocyte membrane protein band 4.1 like 5 with C terminal Flag tag.
    Sinónimo de gene:Epb41l5
    Espécie:Rat
    Vetor:pCMV3-C-FLAG
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with EPB4.1L5 qPCR primers for gene expression analysis, RP301087 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81130-ACG$245
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81130-ACR$245
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81130-ANG$245
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81130-ANR$245
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81130-CF$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81130-CH$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81130-CM$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81130-CY$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81130-NF$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81130-NH$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81130-NM$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81130-NY$215
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de expressão)RG81130-U$75
    Ratazana EPB4.1L5 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81130-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: RG81130-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"