Encomenda rápida

Ratazana CD131/CSF2RB/IL3RB/IL5RB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CSF2RB Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2691bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage) with C terminal HA tag.
Sinónimo de gene:Csf2rb1, Csf2rb
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazana CD131/CSF2RB/IL3RB/IL5RB clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Product nameProduct name

Colony stimulating factor 2 receptor, beta, low-affinity (CSF2RB) also known as CD131 antigen (CD131), cytokine receptor common subunit beta, GM-CSF/IL-3/IL-5 receptor common beta-chain, interleukin 3 receptor/granulocyte-macrophage colony stimulating factor 3 receptor, beta (IL3RB), is the common beta chain of the high affinity receptor for IL-3, IL-5 and CSF. Defects in this protein have been reported to be associated with protein alveolar proteinosis (PAP). CD131 belongs to the type I cytokine receptor family. The cluster of differentiation (cluster of designation) (often abbreviated as CD) is a protocol used for the identification and investigation of cell surface molecules present on white blood cells initially but found in almost any kind of cell of the body, providing targets for immunophenotyping of cells. Defects in CD131/CSF2RB are the cause of pulmonary surfactant metabolism dysfunction type 5 (SMDP5). SMDP5 is a rare lung disorder due to impaired surfactant homeostasis. It is characterized by alveolar filling with floccular material that stains positive using the periodic acid-Schiff method and is derived from surfactant phospholipids and protein components. Excessive lipoproteins accumulation in the alveoli results in severe respiratory distress.

  • Selleri S, et al. (2008) GM-CSF/IL-3/IL-5 receptor common beta chain (CD131) expression as a biomarker of antigen-stimulated CD8+ T cells. J Transl Med. 6:17.
  • Woodcock, et al. (1994) Three residues in the common beta chain of the human GM-CSF, IL-3 and IL-5 receptors are essential for GM-CSF and IL-5 but not IL-3 high affinity binding and interact with Glu21 of GM-CSF. EMBO J. 13(21): 5176-85.
  • Dirksen U, et al. (1997) Human pulmonary alveolar proteinosis associated with a defect in GM-CSF/IL-3/IL-5 receptor common beta chain expression. J Clin Invest. 100(9): 2211-7.
  • Size / Price
    Catálogo: RG80323-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.