Alpha B Crystallin cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80695-NM

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Alpha B Crystallin Reagents

CRO Services

Product recommended


All Alpha B Crystallin Reagents

Alpha B Crystallin cDNA ORF Clone, Rat, N-Myc tag General Information

Gene

Species
Rat
NCBI Ref Seq
RefSeq ORF Size
528 bp
Description
Full length Clone DNA of Rat crystallin, alpha B with N terminal Myc tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Alpha B Crystallin Background Information

Alpha B-Crystallin (CRYAB) is purported to be a metastasis suppressor protein, and lack or lower CRYAB expression is a prognostic biomarker for several types of cancer, such as that of the prostate and head and neck. Mutations in alpha-B crystallin gene (CRYAB) have been described to cause congenital cataracts, dilated cardiomyopathy and myofibrillar myopathy. Mutations in the alphaB-crystallin (CRYAB) gene, encoding a small heat shock protein with chaperone function, are a rare cause of myofibrillar myopathy with autosomal-dominant inheritance, late-onset and moderate severity. Mutations in the CRYAB gene, encoding alpha-B crystallin, cause distinct clinical phenotypes including isolated posterior polar cataract, myofibrillar myopathy, cardiomyopathy, or a multisystemic disorder combining all these features. CRYAB may be identified as a novel prognostic marker and targeting CRYAB may provide a promising strategy for NSCLC treatment.
Full Name
crystallin, alpha B

Alpha B Crystallin cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Alpha B Crystallin cDNA ORF Clone in Cloning Vector, Canine DG70208-U
Alpha B Crystallin cDNA ORF Clone, Canine, untagged DG70208-UT
Alpha B Crystallin cDNA ORF Clone, Canine, C-GFPSpark® tag DG70208-ACG
Alpha B Crystallin Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70208-ACGLN
Alpha B Crystallin cDNA ORF Clone, Canine, N-GFPSpark® tag DG70208-ANG
Alpha B Crystallin cDNA ORF Clone, Canine, C-OFPSpark® tag DG70208-ACR
Alpha B Crystallin cDNA ORF Clone, Canine, N-OFPSpark® tag DG70208-ANR
Alpha B Crystallin cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70208-CF
Alpha B Crystallin cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70208-NF
Alpha B Crystallin cDNA ORF Clone, Canine, C-His tag DG70208-CH
Alpha B Crystallin cDNA ORF Clone, Canine, N-His tag DG70208-NH
Alpha B Crystallin cDNA ORF Clone, Canine, C-HA tag DG70208-CY
Alpha B Crystallin cDNA ORF Clone, Canine, N-HA tag DG70208-NY
Alpha B Crystallin cDNA ORF Clone, Canine, C-Myc tag DG70208-CM
Alpha B Crystallin cDNA ORF Clone, Canine, N-Myc tag DG70208-NM

Alpha B Crystallin cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
Alpha B Crystallin cDNA ORF Clone in Cloning Vector, Rabbit TG65048-G
Alpha B Crystallin cDNA ORF Clone, Rabbit, untagged TG65048-UT
Alpha B Crystallin cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65048-ACG
Alpha B Crystallin Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65048-ACGLN
Alpha B Crystallin cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65048-ANG
Alpha B Crystallin cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65048-ACR
Alpha B Crystallin cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65048-ANR
Alpha B Crystallin cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65048-CF
Alpha B Crystallin cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65048-NF
Alpha B Crystallin cDNA ORF Clone, Rabbit, C-His tag TG65048-CH
Alpha B Crystallin cDNA ORF Clone, Rabbit, N-His tag TG65048-NH
Alpha B Crystallin cDNA ORF Clone, Rabbit, C-HA tag TG65048-CY
Alpha B Crystallin cDNA ORF Clone, Rabbit, N-HA tag TG65048-NY
Alpha B Crystallin cDNA ORF Clone, Rabbit, C-Myc tag TG65048-CM
Alpha B Crystallin cDNA ORF Clone, Rabbit, N-Myc tag TG65048-NM

Alpha B Crystallin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Alpha B Crystallin cDNA ORF Clone in Cloning Vector, Rat RG80695-U
Alpha B Crystallin cDNA ORF Clone, Rat, untagged RG80695-UT
Alpha B Crystallin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80695-ACG
Alpha B Crystallin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80695-ACGLN
Alpha B Crystallin cDNA ORF Clone, Rat, N-GFPSpark® tag RG80695-ANG
Alpha B Crystallin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80695-ACR
Alpha B Crystallin cDNA ORF Clone, Rat, N-OFPSpark® tag RG80695-ANR
Alpha B Crystallin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80695-CF
Alpha B Crystallin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80695-NF
Alpha B Crystallin cDNA ORF Clone, Rat, C-His tag RG80695-CH
Alpha B Crystallin cDNA ORF Clone, Rat, N-His tag RG80695-NH
Alpha B Crystallin cDNA ORF Clone, Rat, C-HA tag RG80695-CY
Alpha B Crystallin cDNA ORF Clone, Rat, N-HA tag RG80695-NY
Alpha B Crystallin cDNA ORF Clone, Rat, C-Myc tag RG80695-CM
Alpha B Crystallin qPCR Primer Pairs, Rat RP300659

Alpha B Crystallin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Alpha B Crystallin cDNA ORF Clone in Cloning Vector, Mouse MG51258-U
Alpha B Crystallin cDNA ORF Clone, Mouse, untagged MG51258-UT
Alpha B Crystallin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51258-ACG
Alpha B Crystallin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51258-ACGLN
Alpha B Crystallin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51258-ANG
Alpha B Crystallin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51258-ACR
Alpha B Crystallin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51258-ANR
Alpha B Crystallin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51258-CF
Alpha B Crystallin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51258-NF
Alpha B Crystallin cDNA ORF Clone, Mouse, C-His tag MG51258-CH
Alpha B Crystallin cDNA ORF Clone, Mouse, N-His tag MG51258-NH
Alpha B Crystallin cDNA ORF Clone, Mouse, C-HA tag MG51258-CY
Alpha B Crystallin cDNA ORF Clone, Mouse, N-HA tag MG51258-NY
Alpha B Crystallin cDNA ORF Clone, Mouse, C-Myc tag MG51258-CM
Alpha B Crystallin cDNA ORF Clone, Mouse, N-Myc tag MG51258-NM
Alpha B Crystallin qPCR Primer Pairs, Mouse MP201140

Alpha B Crystallin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Alpha B Crystallin cDNA ORF Clone in Cloning Vector, Human HG16796-U
Alpha B Crystallin cDNA ORF Clone, Human, untagged HG16796-UT
Alpha B Crystallin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16796-ACGLN
Alpha B Crystallin cDNA ORF Clone, Human, C-GFPSpark® tag HG16796-ACG
Alpha B Crystallin cDNA ORF Clone, Human, N-GFPSpark® tag HG16796-ANG
Alpha B Crystallin cDNA ORF Clone, Human, C-OFPSpark® tag HG16796-ACR
Alpha B Crystallin cDNA ORF Clone, Human, N-OFPSpark® tag HG16796-ANR
Alpha B Crystallin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16796-CF
Alpha B Crystallin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16796-NF
Alpha B Crystallin cDNA ORF Clone, Human, C-His tag HG16796-CH
Alpha B Crystallin cDNA ORF Clone, Human, N-His tag HG16796-NH
Alpha B Crystallin cDNA ORF Clone, Human, C-HA tag HG16796-CY
Alpha B Crystallin cDNA ORF Clone, Human, N-HA tag HG16796-NY
Alpha B Crystallin cDNA ORF Clone, Human, C-Myc tag HG16796-CM
Alpha B Crystallin cDNA ORF Clone, Human, N-Myc tag HG16796-NM
info info
添加购物车成功! 添加购物车失败!