After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana Carboxypeptidase A2/CPA2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CPA2 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001013083.2
Tamanho de cDNA:1254bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus carboxypeptidase A2 (pancreatic) with N terminal Myc tag.
Sinónimo de gene:Cpa2
Espécie:Rat
Vetor:pCMV3-SP-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazana Carboxypeptidase A2/CPA2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Product nameProduct name
Fundo

Human Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

Referências
  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Size / Price
    Catálogo: RG80715-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"