After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Rat CNTN3 ORF mammalian expression plasmid, C-HA tag

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CNTN3 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:3087bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus contactin 3 (plasmacytoma associated) with C terminal HA tag.
Sinónimo de gene:Pang, BIG-1, Cntn3
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-3, also known as CNTN3 ( BIG-1 in rat and PANG in mouse ), is a GPI-linked glycoprotein that is expressed on cerebellar Purkinje cells, amygdaloid and thalamic neurons and olfactory granule cells. In the brain, Contactin-3 is expressed in frontal lobe, occipital lobe, cerebellum and amygdala. Contactin-3 contains 4 fibronectin type-III domains and 6 Ig-like C2-type (immunoglobulin-like) domains. Human Contactin-3 shares 92% aa identity with mouse Contactin-3.The exact function of Contactin-3 is unclear. Contactin-3 may mediate cell-cell interaction and may promote neurite outgrowth.

  • Yoshihara Y, et al. (1994) BIG-1: a new TAG-1/F3-related member of the immunoglobulin superfamily with neurite outgrowth-promoting activity. Neuron 13(2):415-26.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Size / Price
    Catálogo: RG80316-CY
    Preço de catálogo:   (Save )
    Preço:      [How to order]
    Disponibilidade2-3 weeksInstruções de envio
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.