After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana CLEC5A / MDL1 / MDL-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CLEC5A Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001109377.1
Tamanho de cDNA:573bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 5, member A with C terminal His tag.
Sinónimo de gene:Clec5a
Espécie:Rat
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazana CLEC5A / MDL1 / MDL-1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name
Fundo

CLEC5A, also known as MDL1 and MDL-1, is a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. CLEC5A with dnax-activation protein 12 and may play a role in cell activation. It also functions as a positive regulator of osteoclastogenesis. CLEC5A acts as a key regulator of synovial injury and bone erosion during autoimmune joint inflammation .The binding of dengue virus to CLEC5A triggers signaling through the phosphylation of TYROBP, this interaction does not result in viral entry, but stimulates proinflammatory cytokine release.

Referências
  • Chen ST. et al., 2008, Nature. 453 (7195): 672-6.
  • Davila S. et al., 2010, Genes Immun. 11 (3): 232-8.
  • Hillier LW. et al., 2003, Nature. 424 (6945): 157-64.
  • Size / Price
    Catálogo: RG80259-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"