Encomenda rápida

Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana CLEC4B2 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_001005896.1
    Tamanho de cDNA:627bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member B2 with C terminal His tag.
    Sinónimo de gene:Aplra1, Clec4b2
    Espécie:Rat
    Vetor:pCMV3-C-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CLEC4B2 qPCR primers for gene expression analysis, RP300249 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80265-ACG$225
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80265-ACR$225
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG80265-ANG$225
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG80265-ANR$225
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80265-CF$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80265-CH$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80265-CM$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80265-CY$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80265-G$75
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80265-NF$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80265-NH$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80265-NM$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80265-NY$195
    Ratazana CLEC4B2 / mDCAR1 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80265-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.

    Referências
  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Catálogo: RG80265-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"