After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CHMP1B Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001109533.1
Tamanho de cDNA:591bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus charged multivesicular body protein 1B.
Sinónimo de gene:Chmp1b
Espécie:Rat
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81019-ACG$225
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81019-ACR$225
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaRG81019-ANG$225
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaRG81019-ANR$225
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81019-CF$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81019-CH$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81019-CM$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81019-CY$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81019-NF$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81019-NH$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81019-NM$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81019-NY$195
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de expressão)RG81019-U$75
Ratazana C10orf2/CHMP1B clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81019-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: RG81019-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"