After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana N-Cadherin/CD325/CDH2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CDH2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2721bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus cadherin 2 with C terminal His tag.
Sinónimo de gene:N-cadherin, Cdh2
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazana N-Cadherin/CD325/CDH2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Product nameProduct name

Cadherins are calcium dependent cell adhesion proteins, and they preferentially interact with themselves in a homophilic manner in connecting cells. Cadherin 2 (CDH2), also known as N-Cadherin (neuronal) (NCAD), is a single-pass tranmembrane protein and a cadherin containing 5 cadherin domains. N-Cadherin displays a ubiquitous expression pattern but with different expression levels between endocrine cell types. CDH2 (NCAD) has been shown to play an essential role in normal neuronal development, which is implicated in an array of processes including neuronal differentiation and migration, and axon growth and fasciculation. In addition, N-Cadherin expression was upregulated in human HSC during activation in culture, and function or expression blocking of N-Cadherin promoted apoptosis. During apoptosis, N-Cadherin was cleaved into 20-100 kDa fragments. It may provide a novel target for therapies that are directed toward intimal proliferative disorders, including restenosis and vascular bypass graft failure. N-Cadherin is associated with tumor aggressiveness and metastatic potential and may contribute to tumor progression.

  • Jones M, et al. (2002) N-cadherin upregulation and function in response of smooth muscle cells to arterial injury. Arterioscler Thromb Vasc Biol. 22(12): 1972-7.
  • Nagi C, et al. (2005) N-cadherin expression in breast cancer: correlation with an aggressive histologic variant--invasive micropapillary carcinoma. Breast Cancer Res Treat. 94(3): 225-35.
  • Schrick C, et al. (2007) N-cadherin regulates cytoskeletally associated IQGAP1/ERK signaling and memory formation. Neuron. 55(5): 786-98.
  • Li K, et al. (2010) Downregulation of N-cadherin expression inhibits invasiveness, arrests cell cycle and induces cell apoptosis in esophageal squamous cell carcinoma. Cancer Invest. 28(5): 479-86.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.