Encomenda rápida

Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana CDH13 Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_138889.2
    Tamanho de cDNA:2145bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus cadherin 13 with N terminal His tag.
    Sinónimo de gene:Cdht, Tcad, MGC93172, T-cadherin, Cdh13
    Espécie:Rat
    Vetor:pCMV3-SP-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CDH13 qPCR primers for gene expression analysis, RP300259 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80280-ACG$245
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80280-ACR$245
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80280-CF$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80280-CH$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80280-CM$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80280-CY$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de expressão)RG80280-G$75
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80280-NF$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80280-NH$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80280-NM$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80280-NY$215
    Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80280-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Fundo

    CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

    Referências
  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Catálogo: RG80280-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"