Encomenda rápida

Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CDH13 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:2145bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus cadherin 13 with N terminal His tag.
Sinónimo de gene:Cdht, Tcad, MGC93172, T-cadherin, Cdh13
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80280-ACG$245
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80280-ACR$245
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80280-CF$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80280-CH$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80280-CM$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80280-CY$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de expressão)RG80280-G$75
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80280-NF$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80280-NH$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80280-NM$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80280-NY$215
Ratazana CDH13 / Cadherin-13 / H Cadherin clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80280-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

CDH13, also known as cadherin-13 and H Cadherin, is a member of the cadherin superfamily. CDH13 acts as a negative regulator of axon growth during neural differentiation. It also protects vascular endothelial cells from apoptosis due to oxidative stress, and is associated with resistance to atherosclerosis. CDH13 is localized to the surface of the cell membrane and is anchored by a GPI moiety, rather than by a transmembrane domain. CDH13 gene is hypermethylated in many types of cancer.

  • Hart AB. et al., 2012, PLoS One. 7 (8): e42646.
  • Xu J. et al., 2012, BMC Cancer. 12: 243.
  • Jo J. et al., 2012, Obesity (Silver Spring). 20 (8): 1683-7.
  • Size / Price
    Catálogo: RG80280-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.