After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CDH1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_031334.1
Tamanho de cDNA:2706 bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus cadherin 1 with C terminal His tag.
Sinónimo de gene:Cdh1
Espécie:Rat
Vetor:pCMV3-C-His
Plasmid:pCMV3-ratCDH1-His
Local de restrição:KpnI + XbaI(6kb+2.71kb)
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80274-ACG$325
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80274-ACR$325
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80274-CF$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80274-CH$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80274-CM$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80274-CY$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80274-G$75
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80274-NF$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80274-NH$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80274-NM$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80274-NY$295
Ratazana E-Cadherin/CDH1/E-cad/CD324 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80274-UT$295
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Cadherins are calcium-dependent cell adhesion proteins which preferentially interact with themselves in a homophilic manner in connecting cells, and thus may contribute to the sorting of heterogeneous cell type. E-cadherin (E-Cad), also known as CDH1 and CD324, is a calcium-dependent cell adhesion molecule the intact function of which is crucial for the establishment and maintenance of epithelial tissue polarity and structural integrity. Mutations in CDH1 occur in diffuse type gastric cancer, lobular breast cancer, and endometrial cancer. In human cancers, partial or complete loss of E-cadherin expression correlates with malignancy. During apoptosis or with calcium influx, E-Cad is cleaved by the metalloproteinase to produce fragments of about 38 kDa (E-CAD/CTF1), 33 kDa (E-CAD/CTF2) and 29 kDa (E-CAD/CTF3), respectively. E-Cad has been identified as a potent invasive suppressor, as downregulation of E-cadherin expression is involved in dysfunction of the cell-cell adhesion system, and often correlates with strong invasive potential and poor prognosis of human carcinomas.

Referências
  • Wang HD, et al. (2004) CDH1 germline mutation in hereditary gastric carcinoma. World J Gastroenterol. 10(21): 3088-93.
  • Masterson J, et al. (2007) Posttranslational truncation of E-cadherin and significance for tumour progression. Cells Tissues Organs. 185(1-3): 175-9.
  • Mrgineanu E, et al. (2008) Correlation between E-cadherin abnormal expressions in different types of cancer and the process of metastasis. Rev Med Chir Soc Med Nat Iasi. 112(2): 432-6.
  • Size / Price
    Catálogo: RG80274-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    DisponibilidadeIn Stock
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"