Encomenda rápida

Ratazana CD96/TACTILE clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CD96 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1812bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus CD96 molecule with N terminal His tag.
Sinónimo de gene:Cd96
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. The CD155 ligand CD96 is a member of the Ig superfamily. It's a immunoglobulin-like protein tentatively allocated to the repertoire of human NK receptors. NK cells recognize poliovirus receptor (PVR), a nectins and nectin-like protein family member serve to mediate cell-cell adhesion, cell migration, with the presence of an additional receptor, CD96. CD96 promotes NK cell adhesion to target cells expressing PVR, stimulates cytotoxicity of activated NK cells, and mediates acquisition of PVR from target cells. The effect the cells with mutated CD96 protein lost adhesion and growth activities indicates that CD96 mutations may cause a form of the C syndrome by interfering with cell adhesion and growth.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Anja Fuchs, et al. (2004) Cutting Edge: CD96 (Tactile) Promotes NK Cell-Target Cell Adhesion by Interacting with the Poliovirus Receptor (CD155). The Journal of Immunology.172 (7): 3994-8.
  • Seth S, et al.(2007) The murine pan T cell marker CD96 is an adhesion receptor for CD155 and nectin-1. Biochemical and Biophysical Research Communications. 364 (4): 959-65.
  • Size / Price
    Catálogo: RG80338-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.