Encomenda rápida

Ratazana CD70/CD27L/TNFSF7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CD70 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:588bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus Cd70 molecule with N terminal Flag tag.
Sinónimo de gene:Cd70
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazana CD70/CD27L/TNFSF7 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Product nameProduct name

CD70, a member of the tumor necrosis factor superfamily, is restricted to activated T-and B-lymphocytes and mature dendritic cells. Binding of CD70 to its receptor, CD27, is important in priming, effector functions, differentiation and memory formation of T-cells as well as plasma and memory B-cell generation. Tight control of CD70 expression is required to prevent lethal immunodeficiency. By selective transcription, CD70 is largely confined to activated lymphocytes and dendritic cells (DC). As a type II transmembrane receptor, CD70 is normally expressed on a subset of B, T and NK cells, where it plays a costimulatory role in immune cell activation. Immunohistochemical analysis of CD70 expression in multiple carcinoma types. The restricted expression pattern of CD70 in normal tissues and its widespread expression in various malignancies makes it an attractive target for antibody-based therapeutics. Investigations to exploit CD70 as a cancer target have lead to the identification of potential antibody-based clinical candidates.

  • Adam PJ, et al. (2006) CD70 (TNFSF7) is expressed at high prevalence in renal cell carcinomas and is rapidly internalised on antibody binding. Br J Cancer. 95(3): 298-306.
  • Keller AM, et al. (2007) Costimulatory ligand CD70 is delivered to the immunological synapse by shared intracellular trafficking with MHC class II molecules. Proc Natl Acad Sci U S A. 104(14): 5989-94.
  • Grewal IS. (2008) CD70 as a therapeutic target in human malignancies. Expert Opin Ther Targets. 12(3): 341-51.
  • Boursalian TE, et al. (2009) Targeting CD70 for human therapeutic use. Adv Exp Med Biol. 647: 108-19.
  • Size / Price
    Catálogo: RG80161-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.