Encomenda rápida

Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Ratazana CD6 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1998bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus Cd6 molecule with C terminal His tag.
Sinónimo de gene:OX52, MGC108551, Cd6
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
( We provide with CD6 qPCR primers for gene expression analysis, RP300399 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80311-ACG$245
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80311-ACR$245
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80311-CF$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80311-CH$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80311-CM$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80311-CY$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80311-G$75
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80311-NF$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80311-NH$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80311-NM$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80311-NY$215
Ratazana CD6 / Cluster of Differentiation 6 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80311-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name

T-cell differentiation antigen CD6, also known as TP120 and CD6, is a single-pass type I membrane protein which contains three SRCR domains. CD6 / TP120 is a cell surface glycoprotein expressed primarily on T cells, it may function as a costimulatory molecule and may play a role in autoreactive immune responses. CD6 / TP120 is expressed by thymocytes, mature T-cells, a subset of B-cells known as B-1 cells, and by some cells in the brain. CD6 ligand termed CD166 (previously known as activated leukocyte cell adhesion molecule, ALCAM ) has been identified and shown to be expressed on activated T cells, B cells, thymic epithelium, keratinocytes, and in rheumatoid arthritis synovial tissue. CD6 / TP120 binds to activated leukocyte cell adhesion molecule ( CD166 ), and is considered as a costimulatory molecule involved in lymphocyte activation and thymocyte development. CD6 / TP120 partially associates with the TCR / CD3 complex and colocalizes with it at the center of the mature immunological synapse (IS) on T lymphocytes. During thymic development CD6-dependent signals may contribute both to thymocyte survival, and to the overall functional avidity of selection in both man and mouse.

  • Joo YS. et al., 2000, Arthritis Rheum. 43 (2): 329-35.
  • Singer NG. et al., 2002, Int Immunol. 14 (6): 585-97.
  • Gimferrer I. et al., 2005, J Immunol. 175 (3): 1406-14.
  • Alonso R. et al., 2010, J Autoimmun. 35 (4): 336-41.
  • Size / Price
    Catálogo: RG80311-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.