After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Ratazana CD59 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CD59 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_012925.1
Tamanho de cDNA:381bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus CD59 molecule, complement regulatory protein with C terminal His tag.
Sinónimo de gene:Cd59a, Cd59b, MACIF, MACIP, MAC-IP, Cd59
Espécie:Rat
Vetor:pCMV3-C-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Fundo

CD59 glycoprotein, also known as 20 kDa homologous restriction factor, HRF20, MAC-inhibitory protein, Membrane attack complex inhibition factor, Membrane inhibitor of reactive lysis, MIC11, MIRL and CD59, is a cell membrane protein which contains one UPAR/Ly6 domain. CD59 is a small, highly glycosylated, GPI-linked protein, with a wide expression profile. The soluble form of CD59 from urine retains its specific complement binding activity, but exhibits greatly reduced ability to inhibit MAC assembly on cell membranes. CD59 is a potent inhibitor of the complement membrane attack complex (MAC) action. CD59 was first identified as a regulator of the terminal pathway of complement. It acts by binding to the C8 and/or C9 complements of the assembling MAC, thereby preventing incorporation of the multiple copies of C9 required for complete formation of the osmolytic pore. This inhibitor appears to be species-specific. CD59 is involved in signal transduction for T-cell activation complexed to a protein tyrosine kinase. Defects in CD59 are the cause of CD59 deficiency (CD59D).

Referências
  • Fletcher CM. et al., 1994, Structure. 2: 185-99.
  • Rudd PM. et al., 1997, J Biol Chem. 272: 7229-44.
  • Kimberley FC. et al., 2007, Mol Immunol. 44 (1-3): 73-81.
  • Gong Y. et al., 2007, Sci China C Life Sci. 50 (6): 773-9.
  • Picariello G. et al., 2008, Proteomics 8: 3833-47.
  • Heibeck TH. et al., 2009, J Proteome Res. 8: 3852-61.
  • Size / Price
    Catálogo: RG80299-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"