Encomenda rápida

Text Size:AAA

Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CD5 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_019295.1
Tamanho de cDNA:1476bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus Cd5 molecule with C terminal HA tag.
Sinónimo de gene:MGC114334, Cd5
Espécie:Rat
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG80374-ACG$225
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG80374-ACR$225
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG80374-CF$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG80374-CH$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG80374-CM$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG80374-CY$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de expressão)RG80374-G$75
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG80374-NF$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG80374-NH$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG80374-NM$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG80374-NY$195
Ratazana CD5 / Cluster of Differentiation 5 clonagem de ADN ou de clonagem do gene (vector de clonagem)RG80374-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD5 is a member of the CD system. CD5 was found to be widely distributed in T-cells and B1 cells which is a subset of IgM-secreting B cells. CD5 also was found expressed in small lymphocytic lymphoma, hairy cell leukaemia and mantle cell lymphoma cells. CD5 serves to weaken the activating stimulus from the BCR so that the B1 cells can only reflect to the very strong stimuli but not the normal tissue proteins.

Referências
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters. 134 (2): 104-12.
  • Kirchgessner H, et al. (2001) The transmembrane adaptor protein TRIM regulates T cell receptor (TCR) expression and TCR-mediated signaling via an association with the TCR zeta chain. J Exp Med. 193 (11): 1269-84.
  • Size / Price
    Catálogo: RG80374-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"