Encomenda rápida

Ratazana CD47 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CD47 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:912bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus Cd47 molecule with N terminal His tag.
Sinónimo de gene:Itgp, MGC93490, Cd47
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name

CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • Size / Price
    Catálogo: RG80305-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.