Encomenda rápida

Text Size:AAA

Ratazana CD40/TNFRSF5 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CD40 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:870bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus CD40 molecule, TNF receptor superfamily member 5 with N terminal Flag tag.
Sinónimo de gene:Tnfrsf5, Cd40
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

CD40, also known as TNFRSF5, is a member of the TNF receptor superfamily which are single transmembrane-spanning glycoproteins. CD40 protein plays an essential role in mediating a broad variety of immune and inflammatory responses including T cell-dependent immunoglobulin class switching, memory B cell development, and germinal center formation. CD40 protein is expressed in B cells, dendritic cells, macrophages, endothelial cells, and several tumor cell lines. Defects in CD40 result in hyper-IgM immunodeficiency type 3 (HIGM3). In addition, CD40/CD40L interaction is found to be necessary for amyloid-beta-induced microglial activation, and thus is thought to be an early event in Alzheimer disease pathogenesis.

  • van Kooten C, et al. (2000). CD40-CD40 ligand. J Leukoc Biol. 67 (1): 2-17.
  • Bhushan A, et al. (2002). CD40:CD40L interactions in X-linked and non-X-linked hyper-IgM syndromes. Immunol Res. 24 (3): 311-24.
  • Chatzigeorgiou A, et al. (2009) CD40/CD40L signaling and its implication in health and disease. Biofactors. 35(6): 474-83.
  • Li R, et al. (2009) Expression of CD40 and CD40L in Gastric Cancer Tissue and Its Clinical Significance. Int J Mol Sci. 10(9): 3900-17.
  • Lievens D, et al. (2009) The multi-functionality of CD40L and its receptor CD40 in atherosclerosis. Thromb Haemost. 102(2): 206-14.
  • Size / Price
    Catálogo: RG80151-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.