After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazana CD28/TP44 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat CD28 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_013121.1
Tamanho de cDNA:657bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus Cd28 molecule with N terminal His tag.
Sinónimo de gene:CD28RNA, Cd28
Espécie:Rat
Vetor:pCMV3-SP-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Fundo

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.

Referências
  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.
  • Size / Price
    Catálogo: RG80302-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"