Encomenda rápida

Ratazana Fetuin-A clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana AHSG Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1059bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus alpha-2-HS-glycoprotein with N terminal HA tag.
    Sinónimo de gene:pp63, Aa2-066
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    ( We provide with AHSG qPCR primers for gene expression analysis, RP300433 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name

    Fetuin-A, also known as Alpha-2-HS-Glycoprotein (AHSG), belongs to the Fetuin family, is a plasma binding protein, and is more abundant in fetal than adult blood. It is involved in several functions, such as endocytosis, brain development and the formation of bone tissue. Fetuins are carrier proteins like albumin. Fetuin-A forms soluble complexes with calcium and phosphate and thus is a carrier of otherwise insoluble calcium phosphate. Thus Fetuin-A is a potent inhibitor of pathological calcification. The circulating levels of fetuin-A, a well-described inhibitor of calcification, regulate the cell-dependent process of osteogenesis. The low circulating fetuin-A levels are associated with a greater prevalence and/or severity of Vascular calcification (VC) and increased risk for all-cause and cardiovascular mortality. However, high circulating fetuin-A levels appear to induce insulin resistance and, in non-dialyzed subjects with diabetic nephropathy, are directly related to VC burden. The emerging role of fetuin-A deficiency as a risk factor in dialysis patients was documented in cross-sectional studies demonstrating a significant correlation with all-cause and cardiovascular mortality. Additionally, Human fetuin-A is a negative acute phase protein involved in inflammatory diseases, thus being a potential physiological regulator of meprin activity. Fetuin-A is a broad-range protease inhibitor. Fetuin-A and cystatin C as endogenous proteolytic regulators of meprin activity broadens our understanding of the proteolytic network in plasma.

  • Mehrotra R. (2007) Emerging role for fetuin-A as contributor to morbidity and mortality in chronic kidney disease. Kidney Int. 72(2): 137-40.
  • Westenfeld R, et al. (2007) Vascular calcification and fetuin-A deficiency in chronic kidney disease. Trends Cardiovasc Med. 17(4): 124-8.
  • Heiss A, et al. (2008). Hierarchical role of fetuin-A and acidic serum proteins in the formation and stabilization of calcium phosphate particles. J Biol Chem. 283 (21): 14815-25.
  • Jahnen-Dechent W, et al. (2008). Mineral chaperones: a role for fetuin-A and osteopontin in the inhibition and regression of pathologic calcification. J Mol Med. 86 (4): 379-89.
  • Hedrich J, et al. (2010) Fetuin-A and cystatin C are endogenous inhibitors of human meprin metalloproteases. Biochemistry. 49(39): 8599-607.
  • Size / Price
    Catálogo: RG80469-NY
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.