Encomenda rápida

Text Size:AAA

Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat AGA Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1038bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus aspartylglucosaminidase with N terminal Flag tag.
Sinónimo de gene:Aga
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag Etiqueta on other vectors
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaRG81623-ACG$225
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaRG81623-ACR$225
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaRG81623-CF$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaRG81623-CH$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaRG81623-CM$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaRG81623-CY$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de expressão)RG81623-G$75
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaRG81623-NF$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaRG81623-NH$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaRG81623-NM$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaRG81623-NY$195
Ratazana ASRG / Aspartylglucosaminidase clonagem de ADN ou de clonagem do gene (vector de clonagem)RG81623-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name

S100 protein is a family of low molecular weight protein found in vertebrates characterized by two EF-hand calcium-binding motifs. There are at least 21 different S100 proteins, and the name is derived from the fact that the protein is 100% soluble in ammonium sulfate at neutral pH. Most S100 proteins are disulfide-linked homodimer, and is normally present in cells derived from the neural crest, chondrocytes, macrophages, dendritic cells, etc. S100 proteins have been implicated in a variety of intracellular and extracellular functions. They are involved in regulation of protein phosphorylation, transcription factors, the dynamics of cytoskeleton constituents, enzyme activities, cell growth and differentiation, and the inflammatory response.

Human Protein S100-A8, also known as S100 calcium-binding protein A8, Cystic fibrosis antigen, Migration inhibitory factor-related protein 8, S100A8, and CAGA, is a member of the S-100 family. S100A8 plays a role in various functions of myeloid cells by forming a heterocomplex with S100A9. S100A8 and S100A9 are known to be overexpressed in certain species of carcinomas. S100A8 plays an important role in dedifferentiation of thyroid carcinoma possibly by forming a complex with S100A9. S100A8 and S100A9 may also play a key role in inflammation-associated cancer.

  • Donato, R. et al., 2003, Microsc. Res. Tech. 60 (6): 540-551.
  • Gebhardt, C. et al., 2006,  Biochem Pharmacol. 72 (11):1622-31.
  • Nonaka, D. et al., 2008, J. Cutan. Pathol. 35 (11): 1014-1019.
  • Lim, SY. et al., 2008,  J Immunol. 181 (8): 5627-36.
  • Size / Price
    Catálogo: RG81623-NF
    Preço de catálogo: 
    Preço:      (You Save: )
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.