Encomenda rápida

Ratazana ADK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Ratazana ADK Informações sobre o produto de clone de cDNA
    Gene_bank_ref_id:NM_012895.3
    Tamanho de cDNA:1086bp
    Descrição de cDNA:Full length Clone DNA of Rattus norvegicus adenosine kinase with N terminal His tag.
    Sinónimo de gene:AK
    Espécie:Rat
    Vetor:pCMV3-N-His
    Plasmid:
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ADK qPCR primers for gene expression analysis, RP300626 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Ratazana ADK clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
    Product nameProduct name
    Fundo

    Adenosine kinase(ADK) belongs to the family of transferases. Adenosine kinase (ADK) is the key enzyme in adenosine metabolism and catalyzes ATP and adenosine into two products: ADP and AMP. Two isoforms of the enzyme adenosine kinase (ADK), which differ at their N-terminal ends, are found in mammalian cells. It has been shown that the two ADK isoforms differ only in their first exons and the promoter regions; hence they arise via differential splicing of their first exons with the other exons common to both isoforms. In adult brain, ADK is primarily present in astrocytes. Several lines of experimental evidence support a critical role of ADK in different types of brain injury associated with astrogliosis, which is also a prominent morphologic feature of temporal lobe epilepsy (TLE). It has been suggested that dysregulation of ADK in astrocytes is a common pathologic hallmark of TLE. Moreover, in vitro data suggest the existence of an additional layer of modulatory crosstalk between the astrocyte-based adenosine cycle and inflammation. ADK also contributes to CK homeostasis in vivo. 

    Referências
  • Aronica E, et al. (2011) Upregulation of adenosine kinase in astrocytes in experimental and human temporal lobe epilepsy. Epilepsia.52 (9): 1645-55.
  • Kuettel S, et al. (2011) Crystal structures of T. b. rhodesiense adenosine kinase complexed with inhibitor and activator: implications for catalysis and hyperactivation. PLoS Negl Trop Dis. 5 (5): e1164.
  • Cui XA, et al. (2011) Molecular characterization of Chinese hamster cells mutants affected in adenosine kinase and showing novel genetic and biochemical characteristics. BMC Biochem. 12 (1): 22.
  • Size / Price
    Catálogo: RG80662-NH
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"