After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazana ADAM17 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Rat ADAM17 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_020306.1
Tamanho de cDNA:2484bp
Descrição de cDNA:Full length Clone DNA of Rattus norvegicus ADAM metallopeptidase domain 17 with C terminal HA tag.
Sinónimo de gene:TACE, Adam17
Espécie:Rat
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Fundo

ADAM17 is a member of the ADAM protein family of disintegrins and metalloproteases. ADAM17 is ubiquitously expressed in the human colon, with increased activity in the colonic mucosa of patients with ulcerative colitis, a main form of inflammatory bowel disease. The expression of ADAM17 may be inhibited by ethanol. It is involved in the processing of tumor necrosis factor alpha (TNF-α) at the surface of the cell, and from within the intracellular membranes of the trans-Golgi network. ADAM17 also plays a role in the release of a diverse variety of membrane-anchored cytokines, cell adhesion molecules, receptors, ligands, and enzymes. ADAM17 may play a prominent role in the Notch signaling pathway, during the proteolytic release of the Notch intracellular domain (from the Notch1 receptor) that occurs following ligand binding.

Referências
  • Poghosyan. et al., 2002, J Biol Chem. 277 (7): 4999-5007.
  • Li Y. et al., 2006, Blood. 108 (7): 2275-9.
  • Peiretti. et al., 2003, J Cell Sci. 116 (10): 1949-57.
  • Size / Price
    Catálogo: RG80350-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"