Encomenda rápida

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PLA2G2D Informações sobre o produto de clone de cDNA
Tamanho de cDNA:
Descrição de cDNA:
Sinónimo de gene:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Human PLA2G2D Gene Plasmid Map
Human PLA2G2D Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
  • Human PLA2G2D Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Itens recentemente visualizados
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.