After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human PHPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

Folha de dadosAnálisesProdutos relacionadosProtocolos
Human PHPT1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_014172.4
Tamanho de cDNA:378
Descrição de cDNA:ORF Clone of Homo sapiens phosphohistidine phosphatase 1 DNA.
Sinónimo de gene:PHP14, CGI-202, HSPC141, bA216L13.10, RP11-216L13.10
Espécie:Human
Vetor:pCMV/hygro
Local de restrição:KpnI + XhoI
Sequência de etiqueta:
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence.
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Fundo

PHPT1, also known as 14 kDa phosphohistidine phosphatase, phosphohistidine phosphatase 1, protein janus-A homolog, PHP14, is a cytoplasm protein which belongs to the janus family. PHPT1 / PHP14 is expressed abundantly in heart and skeletal muscle. Phosphatases are a diverse group of enzymes that regulate numerous cellular processes. Much of what is known relates to the tyrosine, threonine, and serine phosphatases, whereas the histidine phosphatases have not been studied as much. Protein histidine phosphorylation exists widely in vertebrates, and it plays important roles in signal transduction and other cellular functions. Protein histidine phosphorylation accounts for about 6% of the total protein phosphorylation in eukaryotic cells. The knowledge about eukaryotic PHPT (protein histidine phosphatase) is still very limited. To date, only one vertebrate PHPT has been discovered, and two crystal structures of human PHPT1 have been solved. PHPT1 / PHP14 can dephosphorylate a variety of proteins (e.g. ATP-citrate lyase and the beta-subunit of G proteins). A putative active site has been identified by its electrostatic character, ion binding, and conserved protein residues.

Referências
  • Busam,R.D. et al., 2006, J Biol Chem. 281 (45):33830-4.
  • Zhang,X.Q. et al., 2009, Ups J Med Sci.114 (2):65-72.
  • Gong,W. et al., 2009, Biochem J. 418 (2):337-44.
  • Chapin,L.J. et al., 2009, J Exp Bot. 60 (7):2179-90.
  • Imagens
    • Human PHPT1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"