Encomenda rápida

Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato ZUFSP Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1734bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus zinc finger with UFM1-specific peptidase domain with C terminal His tag.
    Sinónimo de gene:2700019D07Rik
    Local de restrição:
    Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Descrição da sequência:
    ( We provide with ZUFSP qPCR primers for gene expression analysis, MP201585 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51712-ACG$245
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51712-ACR$245
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51712-ANG$245
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51712-ANR$245
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51712-CF$215
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51712-CH$215
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51712-CM$215
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51712-CY$215
    Mouse ZUFSP Gene cDNA clone plasmidMG51712-G$75
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51712-NF$215
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51712-NH$215
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51712-NM$215
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51712-NY$215
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de expressão)MG51712-U$75
    Ratazanao ZUFSP clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51712-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name
    Size / Price
    Catálogo: MG51712-CH
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.