Encomenda rápida

Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse ZCCHC12 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1209bp
Descrição de cDNA:Full length Clone DNA of Mus musculus zinc finger, CCHC domain containing 12 with N terminal His tag.
Sinónimo de gene:Sizn1, AV136720, 2810028A01Rik
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52553-ACG$225
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52553-ACR$225
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52553-ANG$225
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52553-ANR$225
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52553-CF$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52553-CH$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52553-CM$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52553-CY$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52553-G$75
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52553-NF$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52553-NH$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52553-NM$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52553-NY$195
Ratazanao ZCCHC12 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52553-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG52553-NH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.