Encomenda rápida

Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

  • other Green fluorescent protein / GFP Gene Plasmid Map 5609
  • Human VHR ORF mammalian expression plasmid, C-Flag tag
Folha de dadosAnálisesProdutos relacionadosProtocolos
Rato ZBTB16 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001033324.2
Tamanho de cDNA:2022bp
Descrição de cDNA:Full length Clone DNA of Mus musculus zinc finger and BTB domain containing 16 with C terminal Flag tag.
Sinónimo de gene:lu, PLZF, Zfp145, AI467657, Zbtb16
Espécie:Mouse
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 216 A/G, 606 C/T, 861 T/C, 1062 C/T, 1221 C/T, 1731 T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with ZBTB16 qPCR primers for gene expression analysis, MP200988 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51029-ACG$325
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51029-ACR$245
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51029-ANG$245
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51029-ANR$245
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51029-CF$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51029-CH$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51029-CM$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51029-CY$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51029-G$75
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51029-NF$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51029-NH$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51029-NM$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51029-NY$215
Ratazanao ZBTB16 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51029-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51029-CF
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade
Acrescentar a carrinhoBulk Discount Requiry

Datasheet & Documentation

Contact Us
    Itens recentemente visualizados
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"