After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse WARS2 Informações sobre o produto de clone de cDNA
Tamanho de cDNA:1083 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus tryptophanyl tRNA synthetase 2 (mitochondrial)
Sinónimo de gene:5730427B17Rik,9430020O07Rik,AI413375,TrpRS
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His Etiqueta on other vectors
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG53037-ACG$225
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG53037-ACR$225
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG53037-ANG$225
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG53037-ANR$225
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG53037-CF$75
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG53037-CH$195
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG53037-CM$195
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG53037-CY$195
Mouse WARS2 Gene cDNA clone plasmidMG53037-G$75
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG53037-NF$195
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG53037-NH$195
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG53037-NM$195
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG53037-NY$195
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG53037-U$75
Ratazanao WARS2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG53037-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG53037-CH
Preço de catálogo: 
Preço:      (You Save: )
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.