After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TTC38 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_001033337.4
Tamanho de cDNA:1398bp
Descrição de cDNA:Full length Clone DNA of Mus musculus tetratricopeptide repeat domain 38 with N terminal His tag.
Sinónimo de gene:9030019H09
Espécie:Mouse
Vetor:pCMV3-N-His
Plasmid:
Local de restrição:
Sequência de etiqueta:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His Etiqueta on other vectors
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51396-ACG$225
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51396-ACR$225
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51396-ANG$225
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51396-ANR$225
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51396-CF$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51396-CH$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51396-CM$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51396-CY$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51396-G$75
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51396-NF$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51396-NH$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51396-NM$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51396-NY$195
Ratazanao TTC38 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51396-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51396-NH
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"