After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TSC22D1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_009366.3
Tamanho de cDNA:432bp
Descrição de cDNA:Full length Clone DNA of Mus musculus TSC22 domain family, member 1 with C terminal HA tag.
Sinónimo de gene:Tsc, Egr5, Tsc22, TSC-22, Tgfb1i4, AA589566, AW105905
Espécie:Mouse
Vetor:pCMV3-C-HA
Plasmid:
Local de restrição:
Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51196-ACG$225
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51196-ACR$225
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51196-ANG$225
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51196-ANR$225
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51196-CF$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51196-CH$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51196-CM$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51196-CY$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51196-NF$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51196-NH$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51196-NM$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51196-NY$195
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51196-U$75
Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51196-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.

Referências
  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • Size / Price
    Catálogo: MG51196-CY
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        Itens recentemente visualizados
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"