Encomenda rápida

Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato TSC22D1 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:432bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus TSC22 domain family, member 1 with C terminal HA tag.
    Sinónimo de gene:Tsc, Egr5, Tsc22, TSC-22, Tgfb1i4, AA589566, AW105905
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    ( We provide with TSC22D1 qPCR primers for gene expression analysis, MP201080 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA Etiqueta on other vectors
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51196-ACG$225
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51196-ACR$225
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51196-ANG$225
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51196-ANR$225
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51196-CF$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51196-CH$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51196-CM$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51196-CY$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51196-NF$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51196-NH$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51196-NM$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51196-NY$195
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51196-U$75
    Ratazanao TSC22D1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51196-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name

    TSC22 domain family, member 1 (TSC22D1) is one of the TGF-beta-stimulated clone-22 (TSC-22). TSC-22 was reported to be a differentiation-inducing factor which negatively regulates the growth of salivary gland cancer cells. TSC22D1, which encodes transforming growth factor beta-stimulated clone 22 (TSC-22), is thought to be a tumor suppressor because its expression is lost in many glioblastoma, salivary gland, and prostate cancers. TSC-22 is the founding member of the TSC-22/DIP/Bun family of leucine zipper transcription factors. TSC-22 may play an important role in maintaining the differentiated phenotype in salivary gland tumors, and may be a possible target of leukemia therapy. TSC22D1 forms homodimers via its conserved leucine zipper domain and heterodimerizes with TSC22D4. TSC22D1 has transcriptional repressor activity.

  • Doi Y, et al. (2008) Expression and cellular localization of TSC-22 in normal salivary glands and salivary gland tumors: implications for tumor cell differentiation. Oncol Rep. 19(3): 609-16.
  • Wu X, et al. (2008) The Drosophila homolog of human tumor suppressor TSC-22 promotes cellular growth, proliferation, and survival. Proc Natl Acad Sci U S A. 105(14): 5414-9.
  • Lu Y, et al. (2007) Identification of TSC-22 as a potential tumor suppressor that is upregulated by Flt3-D835V but not Flt3-ITD. Leukemia. 21(11): 2246-57.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.