After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TPT1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_008125.3
Tamanho de cDNA:519 bp
Descrição de cDNA:Full length Clone DNA of Mus musculus tumor protein, translationally-controlled 1
Sinónimo de gene:p21,p23,TCTP,Trt
Espécie:Mouse
Vetor:pUC19 Vector
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at ambient temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51648-ACG$225
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51648-ACR$225
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51648-ANG$225
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51648-ANR$225
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51648-CF$75
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51648-CH$195
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51648-CM$195
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51648-CY$195
Mouse TPT1 Gene cDNA clone plasmidMG51648-G$75
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51648-NF$195
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51648-NH$195
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51648-NM$195
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51648-NY$195
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51648-U$75
Ratazanao TCTP /TPT1 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51648-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Tumor protein, also known as TPT1, is a highly conserved protein among many eukaryotic organisms. Tumor protein is involved in a variety of cellular activities, including microtubule stabilization, calcium-binding activities, and apoptosis. The Mammalian translationally controlled tumour protein (TPT1) (or P23) is a protein which has been found to be preferentially synthesised in cells during the early growth phase of some types of tumour, but which is also expressed in normal cells. It was first identified as a histamine-releasing factor, acting in IgE +-dependent allergic reactions. In addition, TPT1 has been shown to bind to tubulin in the cytoskeleton, has a high affinity for calcium, is the binding target for the antimalarial compound artemisinin, and is induced in vitamin D-dependent apoptosis. TPT1 production is thought to be controlled at the translational as well as the transcriptional level.

Referências
  • Thaw P. et al., 2001, Nat Struct Biol. 8 (8): 701-4.
  • Thiele H. et al., 2000, Eur J Biochem. 267 (17): 5473-81.
  • Chitpatima ST. et al., 1988, Nucleic Acids Res. 16 (5): 2350.
  • Size / Price
    Catálogo: MG51648-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"