After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TPP1 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_009906.5
Tamanho de cDNA:1689bp
Descrição de cDNA:Full length Clone DNA of Mus musculus tripeptidyl peptidase I with N terminal Myc tag.
Sinónimo de gene:Cln2; TPP-I
Espécie:Mouse
Vetor:pCMV3-N-Myc
Plasmid:
Local de restrição:
Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc Etiqueta on other vectors
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52010-ACG$245
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52010-ACR$245
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52010-ANG$245
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52010-ANR$245
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52010-CF$215
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52010-CH$215
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52010-CM$215
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52010-CY$215
Mouse TPP1 Gene cDNA clone plasmidMG52010-G$195
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52010-NF$215
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52010-NH$215
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52010-NM$215
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52010-NY$215
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52010-U$75
Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52010-UT$215
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Tripeptidyl-peptidase 1 (TPP1 / CLN2) is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. TPP1 / CLN2 May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Defects in TPP1 / CLN2 are the cause of neuronal ceroid lipofuscinosis type 2 (CLN2), a form of neuronal ceroid lipofuscinosis which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy.

Referências
  • Xin H, et al. (2007) TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 445(7127): 559-62.
  • O'Connor MS, et al. (2006) A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci U S A. 103(32): 11874-9.
  • Abreu E, et al. (2010) TIN2-tethered TPP1 recruits human telomerase to telomeres in vivo. Mol Cell Biol. 30(12): 2971-82.
  • Size / Price
    Catálogo: MG52010-NM
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"