Encomenda rápida

Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato TPP1 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:1689bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus tripeptidyl peptidase I with N terminal HA tag.
    Sinónimo de gene:Cln2; TPP-I
    Local de restrição:
    Sequência de etiqueta:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Descrição da sequência:
    ( We provide with TPP1 qPCR primers for gene expression analysis, MP201883 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA Etiqueta on other vectors
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG52010-ACG$245
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG52010-ACR$245
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG52010-ANG$245
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG52010-ANR$245
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG52010-CF$215
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG52010-CH$215
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG52010-CM$215
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG52010-CY$215
    Mouse TPP1 Gene cDNA clone plasmidMG52010-G$195
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG52010-NF$215
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG52010-NH$215
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG52010-NM$215
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG52010-NY$215
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de expressão)MG52010-U$75
    Ratazanao CLN2 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG52010-UT$215
     Saiba mais sobre vectores de expressão
    Product nameProduct name

    Tripeptidyl-peptidase 1 (TPP1 / CLN2) is a member of the sedolisin family of serine proteases. The protease functions in the lysosome to cleave N-terminal tripeptides from substrates, and has weaker endopeptidase activity. It is synthesized as a catalytically-inactive enzyme which is activated and auto-proteolyzed upon acidification. TPP1 / CLN2 May act as a non-specific lysosomal peptidase which generates tripeptides from the breakdown products produced by lysosomal proteinases. Defects in TPP1 / CLN2 are the cause of neuronal ceroid lipofuscinosis type 2 (CLN2), a form of neuronal ceroid lipofuscinosis which is associated with the failure to degrade specific neuropeptides and a subunit of ATP synthase in the lysosome. Neuronal ceroid lipofuscinoses are progressive neurodegenerative, lysosomal storage diseases characterized by intracellular accumulation of autofluorescent liposomal material, and clinically by seizures, dementia, visual loss, and/or cerebral atrophy.

  • Xin H, et al. (2007) TPP1 is a homologue of ciliate TEBP-beta and interacts with POT1 to recruit telomerase. Nature. 445(7127): 559-62.
  • O'Connor MS, et al. (2006) A critical role for TPP1 and TIN2 interaction in high-order telomeric complex assembly. Proc Natl Acad Sci U S A. 103(32): 11874-9.
  • Abreu E, et al. (2010) TIN2-tethered TPP1 recruits human telomerase to telomeres in vivo. Mol Cell Biol. 30(12): 2971-82.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.