After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem)

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TOMM34 Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_025996.4
Tamanho de cDNA:930bp
Descrição de cDNA:Full length Clone DNA of Mus musculus translocase of outer mitochondrial membrane 34.
Sinónimo de gene:TOM34, Tomm34a, Tomm34b, 2610100K07Rik
Espécie:Mouse
Vetor:pCMV3-untagged
Plasmid:
Local de restrição:
Sequência de etiqueta:
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem) on other vectors
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG51339-ACG$225
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG51339-ACR$225
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-GFPSpark EtiquetaMG51339-ANG$225
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-OFPSpark EtiquetaMG51339-ANR$225
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG51339-CF$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG51339-CH$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG51339-CM$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG51339-CY$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG51339-NF$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG51339-NH$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG51339-NM$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG51339-NY$195
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de expressão)MG51339-U$75
Ratazanao TOMM34 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG51339-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Size / Price
Catálogo: MG51339-UT
Preço de catálogo: 
Preço:      (You Save: )
Tamanho:
Quantidade:+-
Disponibilidade2-3 weeks
Bulk Discount RequiryAcrescentar a carrinho
Contact Us
Imagens
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"