Encomenda rápida

Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta

    Folha de dadosAnálisesProdutos relacionadosProtocolos
    Rato TNFSF11 Informações sobre o produto de clone de cDNA
    Tamanho de cDNA:951bp
    Descrição de cDNA:Full length Clone DNA of Mus musculus tumor necrosis factor (ligand) superfamily, member 11 with C terminal Myc tag.
    Sinónimo de gene:ODF, OPG, OPGL, RANKL, Ly109l, Trance
    Local de restrição:
    Sequência de etiqueta:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Descrição da sequência:
    ( We provide with TNFSF11 qPCR primers for gene expression analysis, MP200365 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc Etiqueta on other vectors
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50343-ACG$225
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50343-ACR$225
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50343-CF$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50343-CH$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50343-CM$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50343-CY$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de expressão)MG50343-M$75
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50343-NF$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50343-NH$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50343-NM$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50343-NY$195
    Ratazanao RANKL/OPGL/TNFSF11/CD254 clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50343-UT$195
     Saiba mais sobre vectores de expressão
    Product nameProduct name

    Tumor necrosis factor ligand superfamily member 11, also known as Receptor activator of nuclear factor kappa-B ligand, Osteoprotegerin ligand, TNFSF11, RANKL, TRANCE, OPGL and CD254, is a single-pass type II membrane protein which belongs to the tumor necrosis factor family. The receptor activator of nuclear factor-kappaB ligand (RANKL), its cognate receptor RANK, and its natural decoy receptor osteoprotegerin have been identified as the final effector molecules of osteoclastic bone resorption. RANK and RANKL are key regulators of bone remodeling and regulate T cell/dendritic cell communications, and lymph node formation. Moreover, RANKL and RANK are expressed in mammary gland epithelial cells and control the development of a lactating mammary gland during pregnancy. Genetically, RANKL and RANK are essential for the development and activation of osteoclasts and bone loss in response to virtually all triggers tested. Inhibition of RANKL function via the natural decoy receptor osteoprotegerin (OPG, TNFRSF11B) prevents bone loss in postmenopausal osteoporosis and cancer metastases. Importantly, RANKL appears to be the pathogenetic principle that causes bone and cartilage destruction in arthritis. RANK-RANKL signaling not only activates a variety of downstream signaling pathways required for osteoclast development, but crosstalk with other signaling pathways also fine-tunes bone homeostasis both in normal physiology and disease. In addition, RANKL and RANK have essential roles in lymph node formation, establishment of the thymic microenvironment, and development of a lactating mammary gland during pregnancy.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Takayanagi H, et al. (2002) Signaling crosstalk between RANKL and interferons in osteoclast differentiation. Arthritis Res. 4 Suppl 3: S227-32.
  • Nakashima T, et al. (2003) RANKL and RANK as novel therapeutic targets for arthritis. Curr Opin Rheumatol. 15(3): 280-7.
  • Schwarz EM, et al. (2007) Clinical development of anti-RANKL therapy. Arthritis Res Ther. 9 Suppl 1: S7.
  • Leibbrandt A, et al. (2008) RANK/RANKL: regulators of immune responses and bone physiology. Ann N Y Acad Sci. 1143: 123-50.
  • Size / Price
    Catálogo: MG50343-CM
    Preço de catálogo: 
    Preço:      (You Save: )
    Acrescentar a carrinhoBulk Discount Requiry

    Datasheet & Documentation

    Contact Us
      Itens recentemente visualizados
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.