After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Encomenda rápida

Text Size:AAA

Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta

Folha de dadosAnálisesProdutos relacionadosProtocolos
Mouse TNFRSF10B Informações sobre o produto de clone de cDNA
Gene_bank_ref_id:NM_020275.4
Tamanho de cDNA:1146bp
Descrição de cDNA:Full length Clone DNA of Mus musculus tumor necrosis factor receptor superfamily, member 10b with C terminal Flag tag.
Sinónimo de gene:MK, DR5, Ly98, KILLER, TRICKB, TRAILR2, TRICK2A, TRICK2B, Tnfrsf10b
Espécie:Mouse
Vetor:pCMV3-C-FLAG
Plasmid:
Local de restrição:
Sequência de etiqueta:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Descrição da sequência:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Armazenamento:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag Etiqueta on other vectors
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-GFPSpark EtiquetaMG50412-ACG$225
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-OFPSpark EtiquetaMG50412-ACR$225
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Flag EtiquetaMG50412-CF$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-His EtiquetaMG50412-CH$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-Myc EtiquetaMG50412-CM$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), C-HA EtiquetaMG50412-CY$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de expressão)MG50412-G$75
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Flag EtiquetaMG50412-NF$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-His EtiquetaMG50412-NH$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-Myc EtiquetaMG50412-NM$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem), N-HA EtiquetaMG50412-NY$195
Ratazanao TRAIL R2/CD262/TNFRSF10B clonagem de ADN ou de clonagem do gene (vector de clonagem)MG50412-UT$195
 Saiba mais sobre vectores de expressão
Product nameProduct name
Fundo

Tumor necrosis factor receptor superfamily, member 10b, official symbol TNFRSF10B, also known as Death receptor 5, CD262, TNF-related apoptosis-inducing ligand receptor 2 (TRAIL R2), is a member of the TNF-receptor superfamily, and contains an intracellular death domain. This receptor can be activated by tumor necrosis factor-related apoptosis inducing ligand (TNFSF10/TRAIL/APO-2L), and transduces an apoptosis signal. Studies with FADD-deficient mice suggested that FADD, a death domain containing adaptor protein, is required for the apoptosis mediated by this protein. TRAIL R2/CD262/TNFRSF10B was purified independently as the only receptor for TRAIL detectable on the surface of two different human cell lines that undergo apoptosis upon stimulation with TRAIL. TRAIL R2/CD262/TNFRSF10B contains two extracellular cysteine-rich repeats, typical for TNF receptor (TNFR) family members, and a cytoplasmic death domain. TRAIL R2/CD262/TNFRSF10B mediates apoptosis via the intracellular adaptor molecule FADD/MORT1. TRAIL receptors can signal both death and gene transcription, functions reminiscent of those of TNFR1 and TRAMP, two other members of the death receptor family. Defects in TRAIL R2/CD262/TNFRSF10B may be a cause of head and neck squamous cell carcinomas (HNSCC) also known as squamous cell carcinoma of the head and neck.

Referências
  • Schneider P, et al. (1997) TRAIL receptors 1 (DR4) and 2 (DR5) signal FADD-dependent apoptosis and activate NF-kappaB. Immunity. 7(6): 831-6.
  • Ichikawa K, et al. (2003) TRAIL-R2 (DR5) mediates apoptosis of synovial fibroblasts in rheumatoid arthritis. J Immunol. 171(2): 1061-9.
  • Walczak H, et al. (1997) TRAIL-R2: a novel apoptosis-mediating receptor for TRAIL. EMBO J. 16(17): 5386-97.
  • Size / Price
    Catálogo: MG50412-CF
    Preço de catálogo: 
    Preço:      (You Save: )
    Tamanho:
    Quantidade:+-
    Disponibilidade2-3 weeks
    Bulk Discount RequiryAcrescentar a carrinho
    Contact Us
    Imagens
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Tenha em atenção o seguinte: Todos os produtos destinam-se "A FINS EXCLUSIVOS DE INVESTIGAÇÃO E NÃO DEVEM SER UTILIZADOS PARA EFEITOS DE DIAGNÓSTICO OU TERAPÊUTICOS"